یک بررسی در مورد روش های تشخیصی بیماری تب مالت

A Review on Diagnostic Methods of Brucellosis

Abstract

We reviewed different diagnostic methods of brucellosis in different livestock and humans. Bacteriological diagnosis, immunohistochemistry (an alternative technique for direct diagnosis) and different molecular methods for Brucella species genotyping are among the direct methods for diagnosis of brucellosis discussed in this review. The well-established indirect methods for diagnosis of brucellosis, serological and brucellin allergic skin tests were also critically conferred. Finally, for effective control and prevention of brucellosis around the world, the direct diagnostic methods are advised in order to develop vaccine against the circulating Brucella strain in the specific country.

1 Introduction

Brucellosis is an ancient disease that can possibly be traced back to the 5th plague of Egypt around 1600 BC. Recent examination of the ancient Egyptian bones, dating to around 750 BC, showed evidence of sacroilitis and other osteoarticular lesions, common complications of brucellosis [1]. David Bruce isolated Brucella melitensis (B. melitensis) (Micrococcus melitensis at that time) in 1887 from the spleen of a British soldier who died from a febrile illness (Malta fever) common among military personnel stationed on Malta. For almost 20 years aіer isolation of M. melitensis, Malta fever remained a mystery and was thought to be a vector-borne disease until Нemistocles Zammit accidentally demonstrated the zoonotic nature of the disease in 1905 by isolating B. melitensis from goat’s milk. It was believed that goats were not the source of infection since they did not become ill when inoculated with Brucella cultures. Нe discovery that healthy goats could be carriers of the disease has been termed one of the greatest advances ever made in the study of epidemiology [2,3].

Brucellosis is caused by Gram-negative coccobacilli of the genus Brucella [4,5]. In livestock, the disease results in significant economic losses due to reproductive impairment caused by abortion, stillbirth or weak calves and neonatal mortality, infertility [6]. In humans, Brucella spp. infection causes a febrile disease that may be associated with a broad spectrum of symptoms, and it may be fatal in some cases [5,7]. Currently, there are ten spp. described in the genus Brucella. Each one may infect diوٴerent host spp., but each Brucella spp. has a preference for its host spp., B. melitensis (sheep and goats), B. abortus (cattle), B. suis (pigs), B. ovis (rams), B. canis (dogs), B. microti (rodents-Microtus arvalis), B. neotomae (rodents – Neotoma lepida), B. pinnipedialis (pinnipeds), B. ceti (cetacea), and B. inopinata (originally isolated from a human patient, but its preferential host is not known) [8,9]. Нree of this Brucella spp. can be subdivided in biotypes [10,11].

Нerefore, three biotypes (1-3) have been identified in B. melitensis; eight biotypes (1-7,9) in B. abortus; and five biotypes (1-5) in B. suis [12]. All Brucella spp. are considered potentially pathogenic for humans, with the exceptions of B. neotomae, B. microti, and B. ovis [6,9].

A precise diagnosis of Brucella spp. infection is important for the control of the disease in animals and consequently in man. Clinical diagnosis is based usually on the history of reproductive failures in livestock, but it is a presumptive diagnosis [13] that must be confirmed by laboratory methods [13,14]. Нe “gold standard” in the diagnosis of brucellosis is bacterial isolation from blood or bone marrow specimens that requires long cultivation periods (4 to 7 days up to 40 days) and oіen the blood cultures are unsuccessful [15]. Serological tests, such as serum agglutination test (SAT), rose Bengal plate test (RBPT), complement fixation test (CFT), and enzyme-linked immunosorbent assay (ELISA) are still frequently used [5,16]. Since the routine identification and diوٴerentiation of brucellosis suspected specimens, based on culture isolation and phenotypic characterization, requires biosafety level-3 (BSL-3) protocols for the high risk of laboratoryacquired infections [17], molecular methods have been explored in order to overcome these diٹculties. Furthermore, the polymerase chain reaction (PCR)-based assays have shown a higher sensitivity with respect to the standard microbiological assay for the diagnosis of brucellosis [18].

Нerefore, the objectives of this paper are to review a diagnostic methods that are used for isolation, screening, monitoring or epidemiological surveillance and complementary or confirmatory for brucellosis in livestock and humans.

مقالات انگلیسی و ترجمه های فارسی رایگان با فرمت PDF آماده دانلود رایگان میباشند

همچنین ترجمه مقاله با فرمت ورد نیز قابل خریداری و دانلود میباشد

مقاله انگلیسی رایگان (PDF)

ترجمه فارسی رایگان (PDF)

خرید ترجمه با فرمت ورد

فهرست مقاله:

1- مقدمه

2- مواد و روش ها

3- نتایج

4- بحث

5- نتیجه گیری

بخشی از ترجمه فارسی مقاله:

1- مقدمه
پمفیگوس به صورت گروهی از اختلالات تاول زای تهدید کننده حیات تعریف می شود ک منجر به به تشکیل تاول های بین پوستی در غشای موکوزی و پوست می شود(1-3).. چهار نوع پمفیگوس شامل پمفیگوس ولگاریس، پمفیگوس فولیسئوس، پمفیگوس ایگا و پمفیگوس پارانئوپلاستیک می باشند. نرخ وقوع بین 0و1 و 0.5 به ازای هر 100000 نفر در سال است. با این حال این نرخ در جمعیت های خاص گزارش شده است(4). ساکنان هند، جنوب شرق اسیا و خاور میانه بیشترین خطر ابتلا به پمفیگوس ولگاریس را دارند. پمفیگوس ولگاریس در مردان و زنان به یک میزان رخ می دهد. در بسیاری از مناطق جغرافیایی، پمفیگوس ولگاریس رایج تر از پمفیگوس فولسئوس است. با این حال در مناطق خاصی نظیر افریقای شمالی، ترکیه و امریکای جنوبی، شیوع پمفیگوس فولسئوس بیش از پمفیگوس ولگاریس است5). پمفیگوس ولگاریس و پمفیگوس فولیسئوس اختلالات تهدید کننده حیات است. اولنی درمان برای این بیماری ها گلوکوکورتویید با و بدون سرکوب کننده های ایمنی ادجونت است. روش های درمانی و مراقبت پوست نیز خطر ابتلا را کاهش می دهد. امکان عفونت ثانویه باید در زمانی در نظر گرفته شود که زخم ها به درمان پاسخ ندهند و عفونت بایستی به طور مناسب در صورت تشخیص درمان شود.عفونت باکترایی به عنوان یک عامل پمفیگوس در نظر گرفته نشده است در حالی که دوز استافیلو کوکوس اورئوس به صورت عارضه درمان سرکوب و یا مهار ایمنی در نظر گرفته می شوتد. باکتری یک عامل عفونی فرصت طلب است زیرا بیماران پمفیگوس با درمان سرکوب ایمنی برای مدت زمان طولانی درمان می شوند. تشخیص اولیه هم زمان پمفیگوس و عفونت باکتریایی، به خصوص استلفیلو کوگوس ، به دلیل عوارض کشنده بیماری، بسیار مهم است. هدف این مطالعه بررسی شیوع عفونت استافیلو کوکوس و ژن PVL در بیماران مبتلا به پمفیگوس ولگاریس است.
2- مواد و روش ها

2-1 جمعیت مورد مطالعه و جمع اوری سویه ها:

این مطالعه مقطعی در 338 بیمار مبتلا به عفونت بافت نرم وپوست مراجعه کننده به درمانگاه پوست رازی تهران انجام شد. بیماران با تشخیص بالاینی پمفیگوس ولگاریس با هیستئپاتولوژی سازگار شناسای شدند و یاتفه های فلورسنس ایمنی مستقیم موید تشخیص بالینی پمفیگوس ولگاریس است. در این مطالعه، تشخیص پمفیگوس ولگاریس توسط الگوی ایمنو فلورسانس و بافت شناسی الگو های پوستی و تست سروم ایمنو فلورسنس غیر مستقیم انجام شد. نمونه های استافیلو کوگوس بالینی که از بیماران پمفیگوس با بیماری پوستی جمع اوری شده بود، برای بررسی به ازمایشگاه میکرو بیولوز/یکی کاشان برای تایید تشخیص ارسال شدند. نمونه های عفونت بافتی پوست از بیماران جمع اوری شده و بر روی اگار نمک مانیتول و اگار خون گوسفند به مدت 24 تا 48 ساعت در 37 درجه کشت شدند.
2-2 شناسایی استافیلو کوگوس: همه سواب ها بر روی اگار مانیتول تلقیح شده و در 37 درجه انکوبات شدند. هیچ یک از کلونی های مشکوک بر روی اگار سویا کشت نشدند و ایزوله ها با ریخت شنسی به صورت استافیوکوکوس، و فعالیت کاتالاز، تست های DNase، تست های اسلاید و انعقاد ازاد پلاسمای خرگوش در لوله شناسایی شدند(11-12)
2-3 تعیین مقاومت متی سیلین: مقاومت متی سیلین با استفاده از دو روش ارزیابی شدو. اولین روش ، روش انتشار دیسک با استفاده از اگار مولر هینتون بر طبق توصیه های موسسه استاندارد بالینی و ازمایشگاهی، دیسک سفوتوکسین 30 میکرو گرم و دیسک اکساسیلین 1 میکروگرم بود. دومین روش، واکنش زنجیره ای پلیمراز برای تشخیص ژن mecA می باشد.
2-4 آزمون حساسیت ضد میکروبی و تعیین MDR: مقاومت و حساسیت ضد میکروبی با روش انتشار دیسک با استفاده از اگار مولر هینتون و بر طبق توصیه های موسسه استاندارد های ازمایشگاهی تعیین شد. دیسک های زیر استفاده شدند: اگزاسیلین (1G)، پنی سیلین (1 گرم)، تریکوپلانین (30 گرم)، تتراسایکلین (30 گرم)، آزیترومایسین (15 گرم)، کلیندامایسین (2 گرم)، سفوتوکسین (30 گرم)، ازاسیون (30 گرم)، جنتامایسین (10 گرم)، لینزولید (30 گرم)، دپانمیسین (30 گرم)، آمیکاسین (30 گرم)، و سفازولین (30 گرم). سویه مرجع S. aureus
ATCC 3359 به عنوان شاهد استفاده شد. نتایج بر طبق معیار های CLSI و پروتوکل شرکت به صورت حساس، متوسط و مقاوم در نظر گرفته شد. تعریف MDR در ایزوله های استافیلو کوگوس بر طبق سند بین المللی استاندارد جدید انجام شد. ایزوله ها به صورت مقاومت چند دارویی طبقه بندی شد به خصوص اگر آن ها مقاوم به بیش از سه داروی ضد میکروبی باشند
2.5 آماده سازی دی ان ای ژنومی:دی ان ای با رو ش جوشاندن تهیه شد. در دمای -20 درجه ذخیره شد. نمونه های 2 میکرو لیتری DNA برای PCR استفاده شد.
2-6 تشخیص ژن PVL: حضور ژن های lukS-PV و lukF-PV کد کننده اجزای PVL با یک روش مبتنی بر واکنش زنجیره پلیمراز با جفت پرایمر توصیف شده توسط لینا و همکاران تعیین شد. 2 پرایمر، در این مطالعه به صورت زیر بودند: ، به صورت پیشرو و به صورت معکوس در نظر کرفته شد(16). در این مطالعه سویه استافیلو کوگوس به عنوان شاهد مثبت استفاده شد و اب مقطر به صورت شاهد منفی استفاده شد. تکثیر دی ان ای بر روی سایکلر اپندورف در حجم نهایی 20 میکرو لیتر حاوی 1.5 mM of MgCl2، 250، 1 U of TaqDNA پلیمراز، 10 mM Tris-HCL (PH 9.0), 30 mM KCL و 4 میکرو لیتر دی ان ای انجام شد. دناتوراسییون در 94 درجه به مدت 45ثانیه و با حرارت 61.3 درجه به مدت 45 دقیقه و اکستنشن در 72 درجه به مدت 45 درجه و اکستنشن نهایی در 72 درجه به مدت 45 ثانیه انجام شد.محصولات PCR با الکتروفورز از طریق ژل اگاروز1.5 درصد جاوی اتیدیدوم برومید حل شدند. کیت تخلیص PCR برای تخلیص محصولات PCR استفاده شده و توالی یابی رشته توسط شرکت بیونر انجام شد. نوکلوتید و توالی ها با نرم افزار کروماس 1.45 و نرم افزار MEGA-4 و BLAST در NCBI تحلیل شد.
2-7 تحلیل آماری: تحلیل آماری با SPSS انجام شد. ازمون کای اسکوئر و تست دقیق فیشر برای مقایسه نسبت ها انجام شد. مقدار P کم تر از 0.05 به صورت معنی دار در نظر گرفته شد.

بخشی از مقاله انگلیسی:

1. Introduction

Pemphigus is defined as a group of life-threatening blistering disorders which results in the formation of intraepithelial blisters in mucous membranes and skin [1–3]. The four major types of pemphigus are pemphigus vulgaris, pemphigus foliaceus, IgA pemphigus, and paraneoplastic pemphigus. Incidence rates between 0.1 and 0.5 per 100,000 people per year have been described; however, higher rates have been reported in certain populations [4]. Inhabitants of India, Southeast Europe, and the Middle East have the greatest risk for pemphigus vulgaris. Pemphigus occurs in men and women with equal frequency. In most geographic locations, pemphigus vulgaris is more common than pemphigus foliaceus. However, in certain locations, such as North Africa, Turkey, and South America, the prevalence of pemphigus foliaceus goes over pemphigus vulgaris [5]. Pemphigus vulgaris and pemphigus foliaceus are potentially life-threatening disorders. First-line treatment for these diseases consists of a systemic glucocorticoid with or without an adjuvant immunosuppressant. Local skin care measures may reduce the risk for infection. The possibility of secondary infection should be considered when lesions fail to respond to therapy, and infection should be treated appropriately if it is detected [6–8]. Bacterial infection was not reported as an inducing factor of pemphigus, while septicemia of Staphylococcus aureus dose occurs, as a complication of immunosuppressive therapy. There are a number of possible clarifications for the association of pemphigus with bacterial infection [9, 10]. The bacteria could simply be an opportunistic infection, because pemphigus patients are treated with immunosuppressive therapy for a long time. Early recognition of concurrent pemphigus and bacterial infection, especially S. aureus, is extremely important because of the possible fatal consequences of the disease. The aim of this study was to assess the prevalence of S. aureus infection and PVL gene in patients with pemphigus.

2. Materials and Methods

2.1. Study Population and Strain Collection.

This cross-sectional study was performed on 338 patients with skin and soft tissue infection who were admitted to Tehran dermatology service of Razi Hospital affiliated to the Tehran University of Medical Sciences. Patients with a clinical diagnosis of pemphigus with compatible histopathology and direct immune fluorescence (DIF) findings confirming the clinical diagnosis of pemphigus entered the study. The diagnosis of pemphigus vulgaris was made by histology, immunofluorescence pattern of perilesional skin, and indirect immunofluorescence testing of serum. A questionnaire was completed to collect the patient’s data. Clinical Staphylococcus aureus samples which were collected from pemphigus patients with skin and soft tissue infection who were admitted to Tehran dermatology service of Razi Hospital affiliated to the Tehran University of Medical Sciences were taken to the microbiology lab of Kashan Medical Faculty to approve the diagnosis of S. aureus. Samples from the skin and soft tissue infection were collected from all patients and were cultured on sheep blood agar and mannitol salt agar incubated for 24–48 h at 37∘ C. The isolates confirmed to the species level by gram staining, catalase activity, DNase, slide coagulase, and free coagulation of citrated rabbit plasma in tube.

2.2. S. aureus Identification. All swabs were inoculated onto mannitol salt agar, incubated at 37∘ C. Any suspected colony was subcultured on tryptic soy agar and the isolates were confirmed as being S. aureus by colonial morphology, Gram staining, catalase activity, DNase tests, slide coagulase test, and free coagulation of citrated rabbit plasma in tube [11, 12].

2.3. Determination of Methicillin Resistance. Methicillin resistance was evaluated using two methods.The first method was disk diffusion method using Mueller Hinton agar according to the recommendations of Clinical and Laboratory Standards Institute (CLSI), 30 ?g cefoxitin disk (≤21 mm indicated MRSA), and 1 ?g oxacillin disk (≤10 mm indicated MRSA). The second method was polymerase chain reaction (PCR) for the detection of mecA gene (positive indicated MRSA) [13, 14].

2.4. Antimicrobial Susceptibility Testing and Determination of MDR. Antimicrobial susceptibility and resistance were determined by disk diffusion method using Mueller Hinton agar according to the recommendations of Clinical and Laboratory Standards Institute (CLSI) [13]. The following disks were used: oxacillin (1 ?g), penicillin (1 ?g), teicoplanin (30 ?g), tetracycline (30 ?g), azithromycin (15 ?g), clindamycin (2 ?g), cefoxitin (30 ?g), ciprofloxacin (30 ?g), gentamicin (10 ?g), linezolid (30 ?g), daptomycin (30 ?g), amikacin (30 ?g), and cefazolin (30 ?g). The reference strain S. aureus ATCC 3359 was used as a control. Results were interpreted as susceptible, intermediate, or resistant according to the criteria recommended by the CLSI and the manufacturer protocols (Mast Group Ltd., Merseyside, UK). Defining of MDR in S. aureusisolates was done according to new standardized international document. The isolates were classified as multidrug resistant (MDR) if they were resistant to more than three classes of antimicrobial drugs [15].

2.5. Preparation of Genomic DNA. DNA was prepared by boiling. It was stored at −20∘ C. Aliquots of 2 ?L of template DNA were used for PCR. 2.6. Detection of PVL Gene. The presence of the lukS-PV and lukF-PV genes encoding components of PVL was determined by a polymerase chain reaction- (PCR-) based method with the primer pair described in Lina et al. 2 Primers used in this study were as follows: 5? ATCATTAGGTAAAATGTCTGGACATGATCCA 3? as forward and 5? GCATCAASTGTATTGGATAGCAAAAGC 3? as reverse [16]. In this study Staphylococcus aureus strain, ATCC 49775, was used as positive control and distilled water was used as a negative control. DNA amplification was performed on an Eppendorf cycler in a final volume of 20 ?L reaction containing 1.5 mM of MgCl2, 250 ?M dNTPmix, 1 ?M of each primer (20 NM), 1 U of Taq DNA polymerase, 10 mM Tris-HCL (PH 9.0), 30 mM KCL, and 4 ?M of template DNA. Amplification was carried out with first denaturation at 94∘ C for 5 min (first denaturation) followed by 36 cycles according to the following program: denaturation at 94∘ C for 45 sec, annealing at 61.3∘ C for 45 sec, and extension at 72∘ C for 45 sec, plus a final extension at 72∘ C for 5 min to complete partial polymerization. The PCR products were resolved by electrophoresis through a 1.5% agarose gel containing ethidium bromide (Bio-Rad, UK). The PCR purification kit (Bioneer Co., Korea) was used to purify PCR products and sequencing of forward strand was performed by the Bioneer Company (Korea). The nucleotide sequences were analyzed with Chromas 1.45 software and MEGA-4 software and BLAST in NCBI. 2.7. Statistical Analysis. The statistical analysis was performed with SPSS (version 19, Chicago, IL, USA). The chi-square test or Fisher’s exact test was used to compare proportions. A ? value of < 0.05 was considered significant.

مطالعه الگوهای تجویز آنتی بیوتیک ها در درمان عفونت دستگاه تنفسی تحتانی در بیمارستان سوهاج

Study of prescription patterns of antibiotics in treating lower respiratory tract infections at Sohag Chest Hospital

Abstract

Background: Most people will develop an acute respiratory tract infection (RTI) every year. RTIs are also the commonest acute problem dealt with in primary care – the ‘bread and butter’ of daily practice. Management of acute RTIs in the past concentrated on advising prompt antibiotic treatment of presumptive bacterial infections. Objective: To study the prescription patterns of antibiotics in treating lower respiratory tract infections at Sohag Chest Hospital. Patients and methods: This study included 50 adult in-patients with lower respiratory tract infections admitted at Sohag Chest Hospital and 20 chest physicians working at the same hospital. The study depended upon collecting data from a questionnaire directed to the chest physicians. The 50 patients were subjected to full medical history and examination, chest X-rays and antibiotics received as regards the route of administration, duration of treatment and possible switch therapy. Results: Forty percent of the physicians considered text books and thirty percent of the physicians considered pharmaceutical companies as a main source of information about antibiotics. Ninety-five percent of physicians used to prescribe AB empirically. Sixty percent of physicians considered their own experience as a reference for empirical AB prescription. Almost all of the physicians considered the presence of co-morbid diseases during AB prescription. Eighty percent of physicians considered the severity of infection as the most important factor affecting the route of AB administration. The results also showed that forty-five percent of physicians considered quinolones as the most common AB prescribed for empirical therapy. Fifty percent of physicians considered the 4–7 day duration for empirical therapy. Sixty-five percent of physicians considered improvement of general condition as the most important factor in determining the efficacy of AB prescribed. Forty percent of physicians considered 2–3 day duration was enough to assess the efficacy of AB prescribed. Fifty percent of physicians included in the study changed the AB group in case the prescribed AB was ineffective. The study showed that a majority of physicians used to make sure that the prescribed AB was the one actually given to the patient. Most of the physicians used to ask the patient before prescribing the AB if he was sensitive to a certain AB. Seventy-five percent of physicians used to ask the patient about AB history in the last 3 months. As regards fifty percent of physicians, their AB prescription decision might be sometimes affected by the patient. Conclusions: AB prescription practices need to be well evaluated in order to formulate an acceptable rationale aiming at improving the global situation of antibiotic use. Many points have to be taken into consideration such as increasing awareness of physicians about different widely accepted guidelines.

1 Introduction

Antibiotics are of the oldest discovered drugs that combat specific micro organisms like bacteria and fungi. Although there are several classification schemes for antibiotics, based on bacterial spectrum (broad vs. narrow) or route of administration (injectable vs. oral vs. topical), or type of activity (bactericidal vs. bacteriostatic), the most useful is based on the chemical structure. Antibiotics within a structural class will generally show similar patterns of effectiveness, toxicity and allergic potential [1]. Antibiotics are the most frequently prescribed drugs among hospitalized patients and there are reported concerns about the continuous indiscriminate and excessive use of antimicrobial agents that promote the emergence of antibiotic-resistant organisms [2]. The global spread of antimicrobial resistance has become a pressing problem, with a focus on the ICU due to the increasing administration of ineffective antimicrobial regimens associated with greater morbidity and mortality [3]. Antibiotics are often thought to be the first line treatment in lower respiratory tract infections; however, these are not indicated in viral infections. It is important to use an appropriate antibiotic selection based on the infecting organism and to ensure this therapy changes with the evolving nature of these infections and the emerging resistance to conventional therapies [4]. There are a number of acute and chronic infections that can affect the lower respiratory tract. The two most common infections are bronchitis and pneumonia [5]. Acute respiratory infections (ARIs) are common and cause significant morbidity and contribute significantly to the overall disease load on the community [6]. In addition to their important social impact, ARIs are frequent causes of medical care and consumption of antibiotics [7].

تصویربرداری از بیمار با درد ساکرولیاک

Imaging the Patient With Sacroiliac Pain

Abstract

Sacroiliac (SI) region pain is a common clinical presentation and is often due to pathology involving the SI joints, usually of inflammatory, infective, neoplastic, or post-traumatic etiology. The SI joints have a unique anatomic layout and composition and can be imaged with a variety of techniques including conventional radiographs, computed tomography, isotope bone scintigraphy, and magnetic resonance imaging. This article reviews a range of common SI joint conditions, illustrated by multimodality imaging findings. We also discuss strategies for choosing the optimal imaging modality, pearls, and pitfalls of imaging and discuss an algorithm for approaching the patient with suspected inflammatory back pain.

1 Introduction

Low back pain not uncommonly arises secondary to pathology in the sacroiliac (SI) joints, which can include inflammatory, infective, neoplastic, and post-traumatic conditions. Many patients with lower back or SI region pain will present to their primary care physician, specialist rheumatologist, or orthopaedic surgeon. The initial challenge for the physician is to confirm origin of symptoms from the SI joint. The criterion standard for confirmation of SI pain is relief of symptoms after image guided SI joint injection [1]. Clinical evaluation of the SI joint should include the posterior superior iliac spine distraction test, pelvic compression and distraction, Gaenslen’s test and the flexion, abduction, and external rotation test [2]. SI joint pain can be differentiated from discogenic lower back pain by the lack of neurological features and a normal straight leg raising test. Piriformis syndrome can also cause similar posterior thigh and buttock pain but can be differentiated by application of the passive flexion, adduction, and internal rotation test. Following a thorough clinical assessment and appropriate laboratory investigations, imaging forms the next major step in the investigation of patients with suspected inflammatory back pain (IBP) or SI joint pathology and various imaging modalities are available to the clinician [3,4]. Increasingly, advanced imaging modalities such as magnetic resonance imaging (MRI) are being used to detect early changes of sacroiliitis and expedite diagnosis in patients with IBP, allowing prompt commencement of disease modifying therapy [3,5,6].

مروری بر بیماری هیداتید در کودکان ایرانی

Overview of Hydatid Disease in Iranian Children

Abstract

Background: Hydatid disease (HD) is still an important health hazard in the world. This disease is a parasitic infestation endemic in many sheep- and cattle-raising areas such as Iran. Objectives: This study aimed to review the clinical manifestations, laboratory aspects, imaging findings, and management of HD. Patients and Methods: Data were collected from the medical records of patients diagnosed with HD in eight referral hospitals in different provinces of Iran from 2001 to 2014. Results: Overall, 161 children at a mean age of 9.25 ± 3.37 years (age range = 1 – 15 years old) hospitalized with a definite diagnosis of the hydatid cyst between 2001 and 2014 were studied. The male-to-female ratio was 1.6:1. The most commonly involved organ was the lung (67.1%), followed by the liver (44.1%) and a combined liver and lung involvement was found in 15.5% of the patients. The cysts were found more frequently in the right lobe of the liver and lung than in the left lobe. The most frequent complaints were fever (35.4%) and abdominal pain (31.7%), and the most frequent sign was an abdominal mass in the liver involvement and cough in the lung involvement. There was a high eosinophil count (> 500/micL) in 41% of our cases. A high erythrocyte sedimentation rate (> 30) or positive C-reactive protein (based on the qualitative method) was found in 18.6% of the patients and leukocytosis > 15000/micL in 29.2% of the children. Ultrasonography was the main imaging test, with an accuracy rate of 96%, and chest X-ray was helpful in 88.6% of the cases. Surgery was performed in 89% of the patients, and selective patients underwent percutaneous aspiration-injection-reaspiration drainage or medical treatment. Conclusions: The lung was the most commonly involved organ in the children recruited in the present study. Given the high probability of multiple organ involvement, we recommend that patients with HD be assessed via ultrasonography and chest X-ray. In endemic regions, unexplained eosinophilia should be considered as a parasitic disease like HD and its complications.

1- Background

Hydatid disease (HD), also known as hydatidosis, is still a global problem in highly endemic areas such as Iran (1, 2). The hydatid cyst is the larval stage of Echinococcus granulosus, which is hosted by dogs and other canines (3, 4). Humans are intermediate hosts by eating the tapeworm eggs (5). According to recent estimations, echinococcosis is responsible for about 1 – 220/10000 infections in the common areas (2, 6, 7). HD is commonly asymptomatic, and often the cysts are detected incidentally (8). In other cases, the symptoms vary largely and are non-specific, depending on the location, size, rupture, and infection of the cysts (9). The liver and lung are the most commonly involved organs in humans; and in children, the lung is more frequently infected (10-14). An elevated eosinophil count in a patient from an endemic region accompanied by non-specific symptoms such as abdominal pain, abdominal mass, and cough, is suggestive of HD (15). The diagnosis is usually made via imaging modalities (i.e. ultrasonography and chest Xray) and confirmed by pathology (16). Surgery is the chief therapeutic method for the management of HD, although currently percutaneous aspiration-injection-reaspiration drainage is regarded as a first choice in many cases (9, 14). The present study was performed to evaluate the epidemiological aspects, clinical presentations, paraclinical findings, and management of HD in Iranian children.

2- Objectives

We sought to review the clinical manifestations, laboratory aspects, imaging findings, and management of HD.

3- Patients and Methods

In this retrospective study, we investigated the medical records of 161 patients (1 – 15 years old) with a definite diagnosis of HD admitted to eight major referral hospitals of Iran during a 13-year period (2001 – 2013). Data were collected on sex, age, clinical manifestations, anatomical location of the cysts, size and number of the cysts, laboratory tests, and therapeutic management. Statistical analysis was carried out using statistical package for the social sciences (SPSS) version 18.

مقاله انگلیسی رایگان (PDF)

ترجمه فارسی رایگان (PDF)

خرید ترجمه با فرمت ورد

بخشی از ترجمه فارسی مقاله:

بحث
بیماران مبتلا به فیبروز کیستیک مستعد کلنیزه شدن و عفونت با گروه بزرگی از میکروب ها هستند. برخی از باکتری ها، مانند سودوموناس آئروژینوزا، استافیلوکوکوس اورئوس، و استنوتروفوموناس مالتوفیلیا، باعث سرعت بخشیدن به بدتر شدن بیماری ریوی می شوند، در حالی که برای بقیه اطلاعات کم و یا هیچ تعریفی برای نقش آنها به عنوان یک پاتوژن یا کلنیزه کننده در بیمار فیبروز کیستیک وجود دارد، و مزایای درمان پس از جداسازی آنها ناشناخته است. [11،12]. مقالات توصیف کننده نوکاردیا در CF عمدتا گزارش موردی هستند، از جمله 1 گزارش توصیف کننده 3 نفر در استرالیا [5] و یک گزارش از 9 نفر در اسپانیا[6]، که این نتیجه رسیدند که جداسازی بیشتر نشان دهنده کلنیزاسیون است تا عفونت. سه گزارش موردی دیگر از کودکان مبتلا به CF و جداسازی نوکاردیا منتشر شد و دیگر عوامل خطر عفونت، مانند درمان با کورتیکواستروئید برای ABPA را پیدا کردند. [7–9]. بیشتر بیماران توصیف شده تحت درمان کوتریموکسازول قرار گرفتند، اما نتایج درمان در مقایسه با بیماران درمان نشده، مشابه و یا ناشناخته بود. [5-9]
تا جایی که میدانیم، مطالعه حاضر اولین مطالعه به منظور بررسی چنین گروه بزرگی از بیماران است که، 25٪ از آنها ناقل یک جهش منحصر به فرد شایع در اسرائیل (W1282X) ، برای یک دوره زمانی طولانی (10 سال) هستند. ما هیچ تفاوت معنی دار آماری در PFTS قبل یا بعد از جداسازی نوکاردیا پیدا نکردیم. هیچ تفاوتی در PFTS بین بیماران با یک رخداد در مقابل کسانی که با رشد راجعه نوکاردیا بودند، و نه در کسانی که تحت درمان با آنتی بیوتیک بودند ؛ برخی برای دوره های طولانی مدت، در مقابل کسانی که تحت درمان قرار نگرفته اند، یافت نشد. هیچ تفاوتی در میانگین FEV1 یا FVC بین بیماران علامت در مقابل افراد بدون علامت در طول دوره وجود ندارد، اما میانگین پایین تر قابل توجهی از FEF 25-75٪ در میان بیماران علامت (35.7 در مقابل 73.3، 0.01 = P) مشاهده شد. با توجه به این یافته ها، ما فرض می کنیم که یک بیماری خطرناکتر از راه های هوایی کوچکتر و شاید درگیری بیشتر پارانشیم می تواند به اختلالات ریوی ذهنی منجر شود.
در این مطالعه ما دوره پیگیری را گسترش دادیم و تغییر در عملکرد ریوی را در سراسر مدت 10 سال، و نه تنها در طول سال جداسازی نوکاردیا، مورد بررسی قرار دادیم و متوجه شدیم که در برخی موارد یک باکتری می تواند ریه ها را بدون رشد کردن در کشت خلط، کلنیزه کند. علاوه بر این، ما بیماران گروه مورد مطالعه را با زوج بیماران CF با وضعیت مشابه مانند همتاهای آنها با نوع جهش، سن و جنس، اما بدون جداسازی نوکاردیا مقایسه کردیم، یک مقایسه که تا این زمان انجام نشده بود. . در این بیماران ما به یک کاهش میانگین FEV1 در هر سال از -1.87٪، شبیه به میزان کاهش میانگین شناخته شده برای بیماران CF دست یافتیم. هیچ تفاوتی در میزان کاهش در مقایسه ی دوره های قبلی برای کشت مثبت نوکاردیا با سال ها پس از جداسازی تا پایان دوره مطالعه شده ،مشاهده نشد. با کمال تعجب، متوسط کاهش FEV1 در هر سال برای بیماران CF گروه شاهد 0.5٪ بود. مقایسه نرخ برای هر دو گروه نشان دهنده اهمیت FEV1 (p=0.08) و FVC (p=0.09) ، بدون هیچ تفاوتی در( FEF25– 75% (p=0.2 است به این معنی که بیماران فیبروز کیستی که کشت خلط آنها با نوکاردیا مثبت بود، سرعت کاهش بیشتری نسبت به کنترل های تطبیق یافته بدون ایزوله کردن این میکروبها ، داشتند. . ممکن است که این تفاوت از نظر آماری معنی دار نباشد چرا که گروه مطالعه کوچک است. از آنجا که به نظر نمی رسد که نوکاردیا باعث کاهش عملکرد ریه شود ، فرض ما این است که این میکروب ممکن است اغلب در بیماران مبتلا به بیماری های ریوی شدیدتر پیش آگهی بدتر رشد کند. شاید دیگر عوامل ژنتیکی یا محیطی ریه های این گروه از بیماران را تحت تاثیر قرار دهد و یا از ریه های بیماران “سالمتر” محافظت کند و آنها را از یکدیگر افتراق دهد. این عوامل باید در گروه های بزرگتر از بیماران بررسی شوند.
در یک مطالعه گذشته نگر قبلی از آریزونا [10]، 17 بیمار مبتلا به CF ، در طول سال های 1997-2007 ( از 123 بیمار 14٪–CF )، کشت خلط مثبت مداوم برای گونه نوکاردیا داشتند- مشابه درصد در کلینیک ما بود . چند بیمار با وجود دوره های مکرر آنتی بیوتیک، کشت خلط مثبت مداوم برای نوکاردیا داشتند و نتایج با آنهایی که یک کشت جدا شده داشتند ، متفاوت نبود. بر خلاف مرکز ما ، در آریزونا 78٪ از موارد با آنتی بیوتیک درمان شدند. با این وجود ،مقدار میانگین FEV1 و FVC هیچ روند خطی معنی داری را قبل، در طی و بعد از یک بار کشت مثبت نوکاردیا در خلط، نشان نداد، که منجر به این نتیجه شد که، درمان به احتمال زیاد هیچ ارزشی در بهبود عملکرد ریه ندارد. مطالعه ما این نتیجه گیری همکارانمان را تقویت کرد.
توصیه های درمانی مطلوب برای نوکاردیوز ریوی بصورت پایدار و محکم به دلیل تغییر در الگوهای حساسیت ضد میکروبی آزمایشگاهی مشخص نشده است. سولفونامیدها ضد میکروبی های انتخاب هستند که 50 سال پیش معرفی شدند[13]. اما به تازگی مقاومت در بیش از 15٪ از ایزوله ها توصیف شده است. [14] آنتی بیوتیک های خوراکی جایگزین استفاده شده ؛ مینوسیکلین و یا داکسی سیکلین هستند، در حالی که برخی گونه های نوکاردیا دارای حساسیت متوسط به کلاولانات آموکسی سیلین یا به فلوروکینولون هستند. چند آنتی بیوتیک وریدی نیز مانند کارباپنم ها، سفتریاکسون، سفوتاکسیم، آمیکاسین، و لینزولید در برابر نوکاردیا موثر هستند. در هنگام درمان نوکاردیوز ریوی، ، درمان ترکیبی باید در نظر گرفته شود و طول درمان 6-12 ماه توصیه می شود. با این حال، همانطور که در مقالات نشان داده شده است و در مطالعه ما مورد تاکید قرار گرفته است، در بیماران مبتلا به CF نیاز به درمان و همچنین مدت درمان کمتر از مدتی است که تعریف شده است.
با این همه، اعتقاد بر این است که ریشه کن کردن نوکاردیا و یا یک دوره بسیار طولانی از درمان ممکن است در برخی بیماران مبتلا به CF مورد نیاز باشد ، به خصوص اگر آنها پیوند ریه انجام داده باشند و یا به دوزهای طولانی مدت و بالا کورتیکواستروئیدها ، مانند درمان ABPA. نیاز داشته باشند. دلیل این کار این است که کورتیکواستروئیدها و همچنین رژیم سرکوب کننده سیستم ایمنی در طول دوره بعد از عمل به خوبی عوامل خطر برای تهاجمی نوکاردیوز و بیماری منتشر که منجر به نرخ بالای مرگ و میر می شود را فراهم می آورد[15،16].
در واقع، توده مدیاستن و تجمع مایع در پریکارد با تامپوناد قلبی به علت یک عفونت نوکاردیال تهاجمی در یک بیمار پیوند کلیه دچار نقص سیستم ایمنی تشخیص داده شد. [17] برخی از محدودیت ها برای مطالعه ما وجود دارد. محدودیت اصلی کوچک بودن نمونه مورد مطالعه است، و نتیجه گیری قطعی دشوار است. با این حال، تا جایی که می دانیم ، بزرگترین گروه مطالعه مورد بررسی قرار گرفته تا کنون، است. به نظر می رسد که یک مطالعه چند مرکزی با موارد بیشتر ، می تواند اطلاعات بیشتر و آمار بهتری را ارائه دهد. روش گذشته نگر مطالعه ما، محدودیت دیگری است. بر این اساس، ما به طور قابل توجهی دوره پیگیری بیماران در مدت مطالعه را گسترش دادیم، که ما را قادر به تخمین تغییرات سالانه در عملکرد ریوی می ساخت. محدودیت دیگر مطالعه ما عدم تمایز نوکاردیا به گونه های مختلف و ایجاد حساسیت دارویی در آزمایشگاه میکروبیولوژیک ما است، که احتمالا می تواند بیماران را به زیر گروه مختلف با توجه به ویرولانس و مقاومت میکروب خاص جدا کند.

بخشی از مقاله انگلیسی:

Discussion

Patients with cystic fibrosis have a predisposition to become colonized and infected by a large array of microbes. Some bacteria, such as Pseudomonas aeruginosa, Staphylococcus aureus, and Stenotrophomonas maltophilia, accelerate the deterioration of pulmonary disease, while others have little or no data to define their role as a pathogen or colonizer in the cystic fibrosis patient, and the benefits of treatment after their isolation is unknown [11,12]. The literature describing Nocardia in CF are mostly case reports, including 1 report describing 3 patients in Australia [5] and a report of 9 patients in Spain [6], which concluded that isolation represents colonization rather than infection. Three more case reports of children with CF and Nocardia isolation were published and found other risk factors for infection, such as corticosteroid treatment for ABPA [7–9]. Most patients described were treated with cotrimoxazole, but the outcomes for the treated versus the untreated patients were similar or unknown [5–9]. To the best of our knowledge, the present study is the first to evaluate such a large cohort of patients, 25% of them carriers of a unique mutation prevalent in Israel (W1282X), for such a long period of time (10 years). We found no statistically significant difference in PFTs before or after the Nocardia isolation. No difference in PFTs were found between patients with a single episode versus those with recurrent Nocardia growth, nor in those treated with antibiotics, some for prolonged periods of time, versus those who were not treated. There was no difference in mean FEV1 or FVC between symptomatic versus asymptomatic patients during the episode, but a significantly lower mean FEF 25–75% was found among the symptomatic patients (35.7 vs. 73.3, p=0.01). Regarding this finding, we hypothesized that a graver disease of the smaller airways and perhaps a more parenchymal involvement could result in subjective pulmonary symptomatology. In this study we expanded the follow­up period and evaluated the changes in pulmonary functions throughout the entire period of 10 years and not only during the year of the episode of Nocardia isolation, realizing that in some cases a bacteria could colonize the lungs without growing in our sputum cultures. Furthermore, we compared our study group patients to paired CF patients with similar status as their peers by mutation class, age, and sex, but no Nocardia isolation, a comparison not carried out until this time. In these patients we found a mean decline of FEV1 per year of −1.87%, similar to the average rate of decline known for CF patients. No difference in the rate of decline was found comparing the period prior to the positive Nocardia culture to the years following the isolation until the end of the study period. Surprisingly, the mean decline of FEV1 per year for our control group CF patients was ­0.5%. Comparing the rates for both groups showed a trend to significance in FEV1 (p=0.08) and FVC (p=0.09), with no difference in FEF25– 75% (p=0.2), meaning that the cystic fibrosis patients who had positive sputum cultures with Nocardia declined faster than matched controls without isolation of this microbe. It is possible that this difference was not statistically significant because of the small study group. Since it does not seem that Nocardia causes a deterioration of lung functions, we hypothesized that this microbe might grow more often in patients with more significant lung disease and worse prognosis. Perhaps other genetic or environmental factors affect the lungs of this group of patients or protect the lungs of the “healthier” patients and differentiate them from each other. These factors will need to be studied in larger groups of patients. In a previous retrospective study from Arizona [10], 17 patients with CF had a sputum culture positive for Nocardia spp. during the years 1997–2007 (of 123 CF patients – 14%), a similar percentage as in our clinic. Several patients had persistent positive Nocardia sputum cultures despite repeated antibiotic courses and did not appear to have different outcomes from the ones with a single isolated culture. As opposed to our center, in Arizona 78% of episodes were treated with antibiotics. Despite this, mean FEV1 and FVC values showed no significant linear trend before, during, and after an episode of positive Nocardia isolation in sputum, which led to the conclusion that treatment likely has no value in improving pulmonary function. Our study strengthens these conclusions of our colleagues. Optimal treatment recommendations for pulmonary Nocardiosis have not been firmly established due to variable in vitro antimicrobial susceptibility patterns. Sulfonamides have been the antimicrobials of choice since they were introduced 50 years ago [13], but resistance has been described lately in up to 15% of the isolates [14]. Alternative antibiotics used orally are minocycline or doxycycline, while some strains of Nocardia are moderately sensitive to amoxicillin­clavulanate or to fluoroquinolones. Several intravenous antibiotics are also effective against Nocardia such as carbapenems, ceftriaxone, cefotaxime, amikacin, and linezolid. When treating pulmonary Nocardiosis, combination therapy should be considered and a duration of 6–12 months of therapy is recommended. However, as shown in the literature and highlighted in our study, in CF patients the need to treat as well as the duration of treatment is less well defined. Despite all this, it is believed that Nocardia eradication or a very long period of treatment might be needed in some patients with CF, especially if they are to undergo lung transplantation or are in need of prolonged and high doses of corticosteroids, such as for treatment of ABPA. The reason for this is that the corticosteroids as well as the immunosuppressive regimen during the post­operative period are well­established risk factors for invasive Nocardiosis and disseminated disease that lead to high rate of mortality [15,16]. Indeed, mediastinal mass and pericardial effusion with cardiac tamponade was diagnosed as an invasive Nocardial infection in a renal transplant immunosuppressed patient [17]. There are some limitations to our study. The major limitation is the small study sample, making firm conclusions difficult. However, it is the largest study group assessed so far, to the best of our knowledge. It seems that a multicenter study with more cases could provide more information and better statistics. The retrospective method of our study is another limitation. Accordingly, we significantly expanded the period of follow­up of the patients to the entire study period, enabling us to estimate yearly changes in pulmonary functions. Another limit of our study was the lack of differentiation of Nocardia into different species and establishment of drug sensitivity in our microbiologic laboratory, which could possibly separate the patients into different sub­groups according to the virulence and resistance of the specific microbe.

حساسیت ضد میکروبی و واژینولیزین در Gardnerella vaginalis از زنان سالم و مبتلا به واژینوز باکتریال

Antimicrobial susceptibility and vaginolysin in Gardnerella vaginalis from healthy and bacterial vaginosis diagnosed women

Abstract

Introduction: Bacterial vaginosis (BV) is a syndrome related to Gardnerella vaginalis and is characterized by an imbalance in the vaginal microbiota. This work focused on the evaluation of antimicrobial susceptibility patterns and the occurrence of the vaginolysin (vly) gene in G. vaginalis isolated from BV and non-BV patients. Methodology: The vaginal secretions were collected randomly and processed for G. vaginalis isolation. The isolates were presumptively identified by β-hemolysis and oxidase and catalase tests. Polymerase chain reaction (PCR) was performed to confirm bacterial identity and to detect the vly gene. Antimicrobial susceptibility patterns were determined. Results: Of 89 patients, G. vaginalis was isolated from 42 (37 BV and 5 non-BV), and 204 isolates were selected (179 from BV and 25 nonBV). The vly gene was detected in all G. vaginalis isolated from non-BV women and in 98.3% of the bacteria from BV patients. High resistance was observed for ampicillin (54.4%), metronidazole (59.8%), tinidazole (60.3%) and secnidazole (71.6%). Conclusions: Further studies are needed to better address the role of G. vaginalis and the vly gene in BV pathogenesis.

1 Introduction

Vaginal microbiota is defined as a diverse group of microorganisms that colonises the vagina without causing disease, considering the host’s regular homeostatic conditions [1]. Bacterial vaginosis (BV) is a polymicrobial syndrome mainly related to Gardnerella vaginalis, characterized by an imbalance in the healthy vaginal microbiota with an increase in anaerobic bacteria, particularly those producing H2O2, which leads to the onset of fetid vaginal discharge [2]. The prevalence of BV is difficult to determine, since a large proportion of infected women are asymptomatic and do not seek medical care, and are not therefore included in the studies. BV is the most common cause of vaginal discharge in women of reproductive age and is more common in black women than white, in those women with intrauterine devices (IUDs), in smokers, in women with multiple sexual partners, and in patients using antibiotics [3]. Anaerobic microorganisms associated with BV mainly include G. vaginalis, Ureaplasma urealyticum, M. hominis, Mobiluncus spp., Bacteroides spp., and Prevotella spp. The microorganisms involved and their products differ significantly between women with BV, and the risk of upper genital tract infections also probably varies between individuals [4]. The isolation of G. vaginalis may not be used for BV diagnosis because it is part of the vaginal microbiota of more than 50% of healthy women. A high concentration of G. vaginalis is often associated with the presence of BV [1].

As the clinical diagnosis of BV has been shown to be vulnerable, different methods have been proposed, such as those of Amsel and Nugent, which include clinical and laboratory observations [5]. Amsel criteria is used as the main clinical approach to BV diagnosis and requires three of the following four criteria: vaginal pH higher than 4.5; presence of adherent white vaginal discharge; finding of vaginal epithelial cells covered with adherent bacteria, the clue cells; and release of volatile amines following the addition of potassium hydroxide to a small amount of vaginal fluid [5,6]. As an alternative to the clinical diagnosis based on Amsel criteria, the Nugent score has been proposed to evaluate the vaginal microbiota through examination of vaginal smears under a microscope [7,8].

شناسایی، کمیت سنجی و تعیین نوع واژینوز باکتریال در نمونه های واژنی بالینی غیرکشت شده توسط PCR کمّی

Identification, quantification and subtyping of Gardnerella vaginalis in noncultured clinical vaginal samples by quantitative PCR

Abstract

Gardnerella vaginalis is an important component of the human vaginal microflora. It is proposed to play a key role in the pathogenesis of bacterial vaginosis (BV), the most common vaginal condition. Here we describe the development, validation and comparative analysis of a novel molecular approach capable of G. vaginalis identification, quantification and subtyping in noncultured vaginal specimens. Using two quantitative PCR (qPCR) assays, we analysed G. vaginalis bacterial loads and clade distribution in 60 clinical vaginal-swab samples. A very high pathogen prevalence was revealed by species-specific qPCR not only among BV patients (100 %), but also in healthy women (97 %), although the G. vaginalis concentration was significantly lower in non-BV samples. G. vaginalis clades identified in vaginal specimens by subtyping multiplex qPCR, which targets four clade-specific genetic markers, had frequencies of 53 % for clade 1, 25 % for clade 2, 32 % for clade 3 and 83 % for clade 4. Multiple clades were found in 70 % of samples. Single G. vaginalis clades were represented by clade 1 and clade 4 in 28 % of specimens. A positive association with BV was shown for clade 1 and clade 3, while clade 2 was positively associated with intermediate vaginal microflora, but not with BV. Clade 4 demonstrated no correlation with the disorder. The presence of multiple clades had a high positive association with BV, whereas G. vaginalis identified as a single clade was negatively linked with the condition. Polyclonal G. vaginalis infection may be a risk factor for BV.

1 Introduction

Gardnerella vaginalis is a facultatively anaerobic, catalaseand oxidase-negative bacterium. G. vaginalis cells are pleomorphic, Gram-negative to Gram-variable, nonencapsulated and non-motile rods with a mean size of 0.5 to 1.5 mm (Greenwood & Pickett, 1980). Initially named Haemophilus vaginalis by discoverers, the microorganism was later referred to as Corynebacterium vaginale and taxonomically assigned as G. vaginalis (Gardner & Dukes, 1955; Piot et al., 1980). Currently it is the only species within the genus Gardnerella (List of Prokaryotic Names with Standing in Nomenclature – www.bacterio. net). G. vaginalis is mainly considered a part of the lower female genital tract microflora (Catlin, 1992). It can also be routinely isolated from the male urogenital tract as was reported in the first publication on this micro-organism and a number of other studies (Briselden & Hillier, 1990; Eren et al., 2011; Leopold, 1953; Swidsinski et al., 2010). The presence of G. vaginalis in the oral cavity and anal samples has also been described (El Aila et al., 2011; Holst, 1990; Marrazzo et al., 2012). Along with disorders in the urinary and genital tracts, G. vaginalis has been identified as a causative agent of bacteraemia, septicaemia with infective endocarditis, vertebral osteomyelitis, acute hip arthritis and retinal vasculitis (Graham et al., 2009; Lagace´- Wiens et al., 2008; Neri et al., 2009; Sivadon-Tardy et al., 2009; Yoon et al., 2010).

Since the moment of discovery G. vaginalis has been linked with bacterial vaginosis (BV), the most common vaginal condition. BV is characterized by the elevation of vaginal pH and clinical symptoms, such as malodorous vaginal discharge and the presence of clue cells visualized on wet mount, although a large percentage of women with BV can be asymptomatic (Amsel et al., 1983; Schwebke & Desmond, 2007). The disorder is associated with a dramatic change in vaginal microflora, when protective Lactobacillus species are depleted and replaced by fastidious anaerobic bacteria including Prevotella, Atopobium, Megasphaera, Sneathia and G. vaginalis (Eschenbach, 1993; Forsum et al., 2005; Nugent et al., 1991). Described as ‘a single etiological agent’ of BV by the discoverers, G. vaginalis, however, failed to fulfil Koch’s postulates for microbial infection in multiple subsequent studies (Catlin, 1992; Holst, 1990; Menard et al., 2008; Zozaya-Hinchliffe et al., 2010). The complex polymicrobial nature of BV and the presence of G. vaginalis in the vaginal milieu of healthy individuals argue against the definition of G. vaginalis as a sole disease-causative species. The micro-organism, nevertheless, remains a prime suspect in the pathogenesis of BV since it is present in 95–100 % of BV patients, although the association of G. vaginalis with Atopobium or Megasphaera has been shown to display better predictive value for this condition (Fredricks et al., 2009; Menard et al., 2008; Muzny & Schwebke, 2013; Schellenberg et al., 2011). It was proposed that G. vaginalis might serve as an initial colonizer critical for the development of BV (Patterson et al., 2010). Some studies suggest that G. vaginalis dominance in the vaginal microflora can represent a distinct transitional or intermediate state between healthy microflora occupied by lactobacilli and BV-type microflora populated with fastidious anaerobes (Schellenberg et al., 2011). After more than half a century the role of G. vaginalis in such an ‘enigmatic’ condition as BV remains obscure.

واژینوز باکتریال مرتبط با Gardnerella vaginalis در زنان بلغاری

Gardnerella vaginalis-associated bacterial vaginosis in Bulgarian women

Abstract

Background Bacterial vaginosis (BV) is the most common cause of vaginal discharge in women of reproductive age. The purpose of this study was to determine the frequency of BV in Bulgarian pregnant and nonpregnant women from several age ranges and to compare three different laboratory methods for Gardnerella vaginalis detection in patents suffering from BV.

Methods Between September 2011 and June 2012, 809 women of 16–40 years of age separated in two major groups: nonpregnant – 469 (355 with and 114 without symptoms) and pregnant – 340 (213 and 127 respectively) were enrolled for the study. The women underwent three different laboratory tests simultaneously: scoring of Gram staining of vaginal smear, culture, and polymerase chain reaction (PCR) assay for G. vaginalis.

Results The microscopic method detected high frequency of BV in symptomatic (57%) whereas only a minority of asymptomatic subjects (14%) were detected. G. vaginalis-associated BV was diagnosed in approximately equal proportions when evaluated with PCR and microscopic method for both pregnant and nonpregnant women. The comparative analysis of microscopic evaluation, culture and PCR assays demonstrated greater concurrence (about 90%) between Gram staining and PCR detection for BV, than both methods compared to culture. The combination of microscopy and PCR turned out to be very reliable and repeatable for detecting G. vaginalis-associated BV.

Conclusions This is the first comparative investigation on the epidemiology of G. vaginalis-associated BV in Bulgaria. The established highest frequency in the young Bulgarian women (21–30 years) is alarming and should be considered in prophylaxis and reproductive programmes.

1 Introduction

Bacterial vaginosis (BV) is the most common cause of unpleasant vaginal odor and discharge in women of reproductive age.1,2 It is induced by an imbalance in naturally occurring microflora. Any change in the resident flora including reduction of lactobacilli allows for different anaerobic bacteria to gain a foothold and multiply.3–7 Nevertheless the process is multifactorial and the initial mechanism of replacement of normal lactobacillary flora by opportunistic pathogens in vaginal ecosystem and the role of intrinsic host factors still remains unclear, requiring more research to be conducted.5–8 The essential participants in pathological polymicrobial associations, which could be used as markers for BV, are Gardnerella vaginalis (that grows under appropriate microaerophilic conditions) and anaerobic Atopobium vaginae.3–8 Other microorganisms involved in BV microbiota are very diverse and include anaerobes, such as Peptostreptococcus spp., Mobiluncus spp., Prevotella spp., Bacteroides spp., Fusobacterium spp., and facultative anaerobes.6–11 It is not clear yet if the BV is a sexually transmitted disease, but it is more common in promiscuous women with hazardous sexual behavior (with multiple and/or new sexual partners; or with female partners, sex during menses).12–18 BV can be an independent risk factor for acquisition of any other sexually transmitted infection.1,15,17 It has also been shown to be a cause for serious health problems as preterm birth, postpartum fever, development of endometritis, post-hysterectomy or postabortal sepsis, and pelvic inflammatory disease.19–21

The purpose of this study was to determine the frequency of BV and G. vaginalis-associated BV in Bulgarian pregnant and nonpregnant women from different age ranges and to compare three distinct laboratory methods for G. vaginalis detections in patients suffering from BV.

مبتدی (مناسب برای درک مفهوم کلی مطلب) (ترجمه به صورت ناقص انجام شده است)

تحلیل آماری
داده ها به طور میانگین به صورت انحراف معیار استاندارد مثبت و منفی نمایش داده شده اند. (SD) برای مقايسه برآورد هزينه های فارماکوکينتيک پس از دوزهای تک و چندگانه، آزمون آماری t-test student 2 برای داده های زوجی مورد استفاده قرار گرفت. مقدار P کمتر از 0.05 به عنوان مقدار قابل توجه در نظر گرفته شد. ارتباطات بین اندازه گیری های فارماکوکینتیک و داده های بیمار (به عنوان مثال سن، قد (Ht)، وزن بدن (Wt)، سطح بدن (BSA)، شاخص توده بدنی) با استفاده از ضریب ارتباط اسپیرمن در سطح قابل توجه 0.05 مورد ارزیابی قرار گرفت. تحلیل آماری با استفاده از نرم افزارSPSS نسخه 11.5 برای ویندوز انجام شد.

نتایج
14 بیمار هفته اول و 12 بیمار هم هفته اول و هم هفته چهارم مطالعات فارماکوکینتیک را به اتمام رساندند. یکی از شرکت کنندگان مطالعه 4 هفته ای را به دلیل مشکالت دسترسی وریدی و سایر سمیت های تزریق شده (تب، خارش و گرفتگی عضلات پا) انجام نداد و نیاز به تعلیق انداختن هفته 4 وجود داشت. همه موارد دیگر به خوبی AmBisome را در این دوز تحمل کردند. میانگین تغییرات در سطح کراتینین سرم بین هفته های 1 و 4 (P=0.12) بود. هيچكدام از بيماران هيپوكالمي، هيپومنيزمي يا افزايش سطح آلكالين فسفاتاز يا تراميناز را نداشتند.
مشخصات زمان متوسط غلظت آمفوتريسين بيليپوزومي در پلاسما پس از دوز اول (هفته 1) و در حالت پایدار (هفته 4) در شکل 1 نشان داده شده است. در نتيجه اندازه گيري غیرلیپوزومی آمفوتريسين B نسبت به درصد کل ليپوزومي، غلظت اولیه دارو به صورت خطی با دوز افزایش نیافته و پس از پایان تزیریق AmBisome در بعضی از بیماران، به دلیل انتشار آمفوتریسین فعال از وسیله لیپوزوم، ادامه داشت. غلظت سرب بین 1 تا 6 ساعت پس از شروع تزریق AmBisome مشاهده شد و در عرض 4 هفته از 2.1 به 4.3 میلی گرم در میلی لیتر و در هفته 4 از 2.6 به 3.8 میلی گرم در لیتر رسید. نیمه عمر حذف از 28.5 تا 107.5 ساعت بود که کوتاه تر از آنچه بود که در بزرگسالان مشاهده شده بود [24].

پارامترهای فارماکوکینتیک بعد از یک دوز مجزا (هفته 1) و در حالت پایدار (هفته 4) برای 12 بیمار که هر دو بخش را تکمیل کرده اند، در جدول 2 خلاصه شده است. برآوردهای پارامتری برای 2 بیمار که تنها هفته اول آزمایش را به اتمام رسانده بوند به صورت مشابه بود. مقايسه پارامترهاي پس از هفته 1 و هفته 4 اختلاف آماري معني داري به جز برای AUC را نشان نداد (جدول 2). AUC، که با توجه به قانون قاعده تطبیقی مشخص شده است، بین 79 تا 275 میلی گرم در ساعت در هفته 1 و 105 تا 462 میلی گرم در ساعت در هفته 4 (P=0.3) متغیر بود.

سطوح پلاسما در 7 روز (Cmin) بعد از دوزهای اول و چهارم به طور قابل توجهی متفاوت نبوده، که نشان می دهد هیچ تجمعی در طول دوره درمان وجود ندارد. نیمه عمر اندازه گیری شده در گروه مطالعه ما کوتاه تر از مقدار گزارش شده در بزرگسالان بود (43-55 ساعت در مقابل 152 ساعت) [24]. مقادیر حجم توزیع (Vz) و شفافیت (CL) در گروه ما بیشتر از مواردی است که در بزرگسالان گزارش شده است و با وزن بدن Vz ارتباط مثبت ارتباط دارد.
(شکل 2 و 3). حجم توزیع به طور معنی داری با Wt، Ht، و BSA برای هر هفته 1 و هفته 4 ارتباط دارد. روند ارتباط بین Wt و شفافیت (هفته اول) وجود داشت که اهمیت آماری نداشت (جدول 3).

فقط یک بیمار (بیمار 3) شواهدی از عفونت قارچی را نشان داد. این کودک تنها یک گره ریه ای را از بین برد و حتی اگر تمامی موارد منفی باقی بمانند، معاینه پاتولوژیک عفونت قارچی را پیشنهاد می کند. بیمار با درمان ضد قارچی تجربی درمان شد و 9 ماه پس از آن حالش خوب بود.

بحث
در این تحقیق به بررسی دوزهای بالای AmBisome پرداختیم که به صورت یک بار در هفته به بچه های کوچک (سن کمتر 10 سال) داده شدند. تمایل ما برای مدیریت هفتگی AmBisome ناشی از 2 منبع بود. اول، مطالعات روی حیوانات نشان دادند که این برنامه برای دوز دارو ممکن است موثر باشد. گارسیا و همکاران [25] از یک مدل عفونت Candida albicans and Histoplasma capsulatum موش [25] برای نشان دادن اثربخشی یک دوز پروفیلاکتیک منفرد AmBisome (20-20 میلی گرم / کیلوگرم) 7 روز قبل از چالش استفاده کردند. این داده ها و داده های اخیر با استفاده از Aspergillosis مهاجم به عنوان یک مدل نشان می دهد که سطوح خون و بافت زیستی مرتبط با دارو ممکن است ناشی از 7 روز پس از تجویز یک دوز منفرد AmBisome باشد [26]. انگیزه دوم برای این تحقیق، چالش بالینی در پیشگیری از پروبیوتیک های ضد قارچی خوراکی درازمدت (به عنوان مثال، با آئول ها) برای کودکان کوچک بود. كودكان كوچك ممكن است دستور مصرف خوراكي را انجام ندهند و سميت كبدي نیز شايع می باشد. درمان جایگزین با اکینوکندین (به عنوان مثال، (caspofungin نیاز به تزریق داخل وریدی روزانه دارد. ما استدلال کردیم که اگر دوزهای هفتگیAmBisome سطوح پلاسمای را به میزان قابل ملاحظه ای فراهم کند، این یک رژیم پیشگیری ساده است که می تواند برای دوره های طولانی به صورت سرپایی در نظر گرفته شود. علاوه بر این، اگر یک برنامه هفتگی امکان پذیر باشد، این استراتژی می تواند برای سایر جمعیت هایی که نیاز به پیشگیری دراز مدت دارند، مانند کودکان مبتلا به سندرم های شکستگی مغز استخوان،AML یا ALL خطر بالا و کمبود های سیستم ایمنی، مورد استفاده قرار گیرد.

مطالعه ما مشخصات فارماکوکینتیک ثابت برای AmBisome تجویز شده در این دوز را با سطح پلاسما آمفوتریسین غیرلیپوزومی قابل تشخیص در روز هفتم قبل از تجویز مجدد و بدون تجمع با دوز مکرر را نشان داده است. مطالعات قبلی در زمان آزمایش و اثرات پس از ضد قارچ (PAFE) با آمفوتریسین B اثبات وابستگی به غلظت و PAFE قابل توجهی را نسبت به انواع مخمرها نشان داده اند [27]. این مورد و مطالعات دیگر نشان داده اند که نسبت حداکثر سطح سرمی / حداقل غلظت مهاری (MIC)، پارامترهای فارماکوکینتیک و فارماکودینامیکی بیشترین تأثیر آن ها بر عملکرد آمفوتریسین B است. علاوه بر این، غلظت سرمی داروها جایگزین نسبتا خوب غلظت بافت است. غلظت آمفوتریسین B غیر لیپوزومی در 7 روز (پایان دوره در این مطالعه) در اطراف MICs برای سویه های حساس است (کاندیدا، 0.25-1 mg / L، Aspergillus، 0.5-2 (mg / L [28].
محدودیت مطالعه ما عدم وجود غلظت های AmBisome بافت اندازه گیری شده است. بیشتر مزایای بالینی AmBisome به احتمال زیاد نیاز به پراکندگی بافت دارو دارد. یک مطالعه جدید نشان داد که دوز 15 میلیگرم در کیلوگرم یکبار در هفته برای AmBisome در بزرگسالان تحت HSCT ، منجر به غلظت های باقیمانده بافت پایدار، مشابه با مقادیر روزانه 1 میلی گرم بر کیلوگرم می شود. میانگین نسبت بافتی و پلاسما نسبت به AmBisome در روز 7 ام برابر با 16.3 بود که نشان دهنده میزان قابل توجهی از داروی بافت در مقایسه با سطح پلاسمای اندازه گیری شده است [29]. این داده ها نشان می دهد که در بزرگسالان، AmBisome را می توان در دوزهای بالا با خیال راحت تجویز کرد و فرضیه ما را تأیید می کند که تجویز AmBisome یک بار در هفته می تواند برای پیشگیری از قارچ در کودکان کوچک موثر باشد.

داده های جمع آوری شده در بزرگسالان که درمانی برای عفونت های قارچی دریافت کرده اند نشان داده اند که دوزهای AmBisome تا 15 میلی گرم / کیلوگرم به خوبی قابل تحمل هستند [30]. حداکثر دوز قابل تحمل (MTD) در این تحقیق حاصل نشد، و سمیت اصلی واکنش های تزریق و اختلال کلیوی به نظر نمی رسد که به دوز مرتبط باشند. این مطالعه نشان داد که فارکرایکونتیک غیر خطی AmBisome در دوزهای mg / kg 10 با افزایش بیشتر در Cmax یا AUC با دوز 12.5 و 15 mg / kg همراه نیست. این داده ها نشان می دهد جذب AmBisome در سیستم رتاتیوالکتومی دهانه رحم، راه اصلی برای استخراج AmBisome از پلاسما، با انباشت دارو در بافت ها است. این یافته بالقوه از حفاظت از کبد و طحال و احتمالا ریه ها در دوزهای بالاتر، بخش هایی که به خصوص در معرض آسیب رساندن به علف کش یا مخمر هستند، حمایت می کند.
ما دوز 10 میلی گرم بر کیلوگرم را در مطالعه خود انتخاب کردیم به علت عدم وجود فارماکوکینتیک غیر خطی AmBisome در دوزهای بالاتر و نیز داده هایی که نشان می دهد این دوز کمتر از MTD AmBisome است، و در بزرگسالان، که دوز آنها 15 میلی گرم / کیلوگرم است به MTD نرسیده است. در مطالعه ما دوز 10 میلی گرم بر کیلوگرم به خوبی قابل تحمل بود و تنها یک مورد سمیت با انفوزیون و بدون سمیت کلیوی، کبد و یا سایر سمیت ها بود که نشان می دهد این یک استراتژی بی خطر برای استفاده طولانی مدت است.
درمان هفتگی AmBisome هزینه های قابل توجهی را نسبت به درمان خوراکی انجام دارد، اما (در اکثر بیمارستانها) ارزانتر از درمان روزانه اکینوکاندین است. درمان هفتگی AmBisome گزینه ای برای پیشگیری درازمدت در کودکان است که قادر به تحمل داروهای آسئول خوراکی نیستند.