دانلود رایگان ترجمه مقاله شیوع عفونت های بافت نرم و پوستی S. aureus در بیماران پمفیگوس – هینداوی 2016

مقالات انگلیسی و ترجمه های فارسی رایگان با فرمت PDF آماده دانلود رایگان میباشند

همچنین ترجمه مقاله با فرمت ورد نیز قابل خریداری و دانلود میباشد

مقاله انگلیسی رایگان (PDF)

ترجمه فارسی رایگان (PDF)

خرید ترجمه با فرمت ورد

فهرست مقاله:

1- مقدمه

2- مواد و روش ها

3- نتایج

4- بحث

5- نتیجه گیری

بخشی از ترجمه فارسی مقاله:

1- مقدمه
پمفیگوس به صورت گروهی از اختلالات تاول زای تهدید کننده حیات تعریف می شود ک منجر به به تشکیل تاول های بین پوستی در غشای موکوزی و پوست می شود(1-3).. چهار نوع پمفیگوس شامل پمفیگوس ولگاریس، پمفیگوس فولیسئوس، پمفیگوس ایگا و پمفیگوس پارانئوپلاستیک می باشند. نرخ وقوع بین 0و1 و 0.5 به ازای هر 100000 نفر در سال است. با این حال این نرخ در جمعیت های خاص گزارش شده است(4). ساکنان هند، جنوب شرق اسیا و خاور میانه بیشترین خطر ابتلا به پمفیگوس ولگاریس را دارند. پمفیگوس ولگاریس در مردان و زنان به یک میزان رخ می دهد. در بسیاری از مناطق جغرافیایی، پمفیگوس ولگاریس رایج تر از پمفیگوس فولسئوس است. با این حال در مناطق خاصی نظیر افریقای شمالی، ترکیه و امریکای جنوبی، شیوع پمفیگوس فولسئوس بیش از پمفیگوس ولگاریس است5). پمفیگوس ولگاریس و پمفیگوس فولیسئوس اختلالات تهدید کننده حیات است. اولنی درمان برای این بیماری ها گلوکوکورتویید با و بدون سرکوب کننده های ایمنی ادجونت است. روش های درمانی و مراقبت پوست نیز خطر ابتلا را کاهش می دهد. امکان عفونت ثانویه باید در زمانی در نظر گرفته شود که زخم ها به درمان پاسخ ندهند و عفونت بایستی به طور مناسب در صورت تشخیص درمان شود.عفونت باکترایی به عنوان یک عامل پمفیگوس در نظر گرفته نشده است در حالی که دوز استافیلو کوکوس اورئوس به صورت عارضه درمان سرکوب و یا مهار ایمنی در نظر گرفته می شوتد. باکتری یک عامل عفونی فرصت طلب است زیرا بیماران پمفیگوس با درمان سرکوب ایمنی برای مدت زمان طولانی درمان می شوند. تشخیص اولیه هم زمان پمفیگوس و عفونت باکتریایی، به خصوص استلفیلو کوگوس ، به دلیل عوارض کشنده بیماری، بسیار مهم است. هدف این مطالعه بررسی شیوع عفونت استافیلو کوکوس و ژن PVL در بیماران مبتلا به پمفیگوس ولگاریس است.
2- مواد و روش ها

2-1 جمعیت مورد مطالعه و جمع اوری سویه ها:

این مطالعه مقطعی در 338 بیمار مبتلا به عفونت بافت نرم وپوست مراجعه کننده به درمانگاه پوست رازی تهران انجام شد. بیماران با تشخیص بالاینی پمفیگوس ولگاریس با هیستئپاتولوژی سازگار شناسای شدند و یاتفه های فلورسنس ایمنی مستقیم موید تشخیص بالینی پمفیگوس ولگاریس است. در این مطالعه، تشخیص پمفیگوس ولگاریس توسط الگوی ایمنو فلورسانس و بافت شناسی الگو های پوستی و تست سروم ایمنو فلورسنس غیر مستقیم انجام شد. نمونه های استافیلو کوگوس بالینی که از بیماران پمفیگوس با بیماری پوستی جمع اوری شده بود، برای بررسی به ازمایشگاه میکرو بیولوز/یکی کاشان برای تایید تشخیص ارسال شدند. نمونه های عفونت بافتی پوست از بیماران جمع اوری شده و بر روی اگار نمک مانیتول و اگار خون گوسفند به مدت 24 تا 48 ساعت در 37 درجه کشت شدند.
2-2 شناسایی استافیلو کوگوس: همه سواب ها بر روی اگار مانیتول تلقیح شده و در 37 درجه انکوبات شدند. هیچ یک از کلونی های مشکوک بر روی اگار سویا کشت نشدند و ایزوله ها با ریخت شنسی به صورت استافیوکوکوس، و فعالیت کاتالاز، تست های DNase، تست های اسلاید و انعقاد ازاد پلاسمای خرگوش در لوله شناسایی شدند(11-12)
2-3 تعیین مقاومت متی سیلین: مقاومت متی سیلین با استفاده از دو روش ارزیابی شدو. اولین روش ، روش انتشار دیسک با استفاده از اگار مولر هینتون بر طبق توصیه های موسسه استاندارد بالینی و ازمایشگاهی، دیسک سفوتوکسین 30 میکرو گرم و دیسک اکساسیلین 1 میکروگرم بود. دومین روش، واکنش زنجیره ای پلیمراز برای تشخیص ژن mecA می باشد.
2-4 آزمون حساسیت ضد میکروبی و تعیین MDR: مقاومت و حساسیت ضد میکروبی با روش انتشار دیسک با استفاده از اگار مولر هینتون و بر طبق توصیه های موسسه استاندارد های ازمایشگاهی تعیین شد. دیسک های زیر استفاده شدند: اگزاسیلین (1G)، پنی سیلین (1 گرم)، تریکوپلانین (30 گرم)، تتراسایکلین (30 گرم)، آزیترومایسین (15 گرم)، کلیندامایسین (2 گرم)، سفوتوکسین (30 گرم)، ازاسیون (30 گرم)، جنتامایسین (10 گرم)، لینزولید (30 گرم)، دپانمیسین (30 گرم)، آمیکاسین (30 گرم)، و سفازولین (30 گرم). سویه مرجع S. aureus
ATCC 3359 به عنوان شاهد استفاده شد. نتایج بر طبق معیار های CLSI و پروتوکل شرکت به صورت حساس، متوسط و مقاوم در نظر گرفته شد. تعریف MDR در ایزوله های استافیلو کوگوس بر طبق سند بین المللی استاندارد جدید انجام شد. ایزوله ها به صورت مقاومت چند دارویی طبقه بندی شد به خصوص اگر آن ها مقاوم به بیش از سه داروی ضد میکروبی باشند
2.5 آماده سازی دی ان ای ژنومی:دی ان ای با رو ش جوشاندن تهیه شد. در دمای -20 درجه ذخیره شد. نمونه های 2 میکرو لیتری DNA برای PCR استفاده شد.
2-6 تشخیص ژن PVL: حضور ژن های lukS-PV و lukF-PV کد کننده اجزای PVL با یک روش مبتنی بر واکنش زنجیره پلیمراز با جفت پرایمر توصیف شده توسط لینا و همکاران تعیین شد. 2 پرایمر، در این مطالعه به صورت زیر بودند: ، به صورت پیشرو و به صورت معکوس در نظر کرفته شد(16). در این مطالعه سویه استافیلو کوگوس به عنوان شاهد مثبت استفاده شد و اب مقطر به صورت شاهد منفی استفاده شد. تکثیر دی ان ای بر روی سایکلر اپندورف در حجم نهایی 20 میکرو لیتر حاوی 1.5 mM of MgCl2، 250، 1 U of TaqDNA پلیمراز، 10 mM Tris-HCL (PH 9.0), 30 mM KCL و 4 میکرو لیتر دی ان ای انجام شد. دناتوراسییون در 94 درجه به مدت 45ثانیه و با حرارت 61.3 درجه به مدت 45 دقیقه و اکستنشن در 72 درجه به مدت 45 درجه و اکستنشن نهایی در 72 درجه به مدت 45 ثانیه انجام شد.محصولات PCR با الکتروفورز از طریق ژل اگاروز1.5 درصد جاوی اتیدیدوم برومید حل شدند. کیت تخلیص PCR برای تخلیص محصولات PCR استفاده شده و توالی یابی رشته توسط شرکت بیونر انجام شد. نوکلوتید و توالی ها با نرم افزار کروماس 1.45 و نرم افزار MEGA-4 و BLAST در NCBI تحلیل شد.
2-7 تحلیل آماری: تحلیل آماری با SPSS انجام شد. ازمون کای اسکوئر و تست دقیق فیشر برای مقایسه نسبت ها انجام شد. مقدار P کم تر از 0.05 به صورت معنی دار در نظر گرفته شد.

بخشی از مقاله انگلیسی:

1. Introduction

Pemphigus is defined as a group of life-threatening blistering disorders which results in the formation of intraepithelial blisters in mucous membranes and skin [1–3]. The four major types of pemphigus are pemphigus vulgaris, pemphigus foliaceus, IgA pemphigus, and paraneoplastic pemphigus. Incidence rates between 0.1 and 0.5 per 100,000 people per year have been described; however, higher rates have been reported in certain populations [4]. Inhabitants of India, Southeast Europe, and the Middle East have the greatest risk for pemphigus vulgaris. Pemphigus occurs in men and women with equal frequency. In most geographic locations, pemphigus vulgaris is more common than pemphigus foliaceus. However, in certain locations, such as North Africa, Turkey, and South America, the prevalence of pemphigus foliaceus goes over pemphigus vulgaris [5]. Pemphigus vulgaris and pemphigus foliaceus are potentially life-threatening disorders. First-line treatment for these diseases consists of a systemic glucocorticoid with or without an adjuvant immunosuppressant. Local skin care measures may reduce the risk for infection. The possibility of secondary infection should be considered when lesions fail to respond to therapy, and infection should be treated appropriately if it is detected [6–8]. Bacterial infection was not reported as an inducing factor of pemphigus, while septicemia of Staphylococcus aureus dose occurs, as a complication of immunosuppressive therapy. There are a number of possible clarifications for the association of pemphigus with bacterial infection [9, 10]. The bacteria could simply be an opportunistic infection, because pemphigus patients are treated with immunosuppressive therapy for a long time. Early recognition of concurrent pemphigus and bacterial infection, especially S. aureus, is extremely important because of the possible fatal consequences of the disease. The aim of this study was to assess the prevalence of S. aureus infection and PVL gene in patients with pemphigus.

2. Materials and Methods

2.1. Study Population and Strain Collection.

This cross-sectional study was performed on 338 patients with skin and soft tissue infection who were admitted to Tehran dermatology service of Razi Hospital affiliated to the Tehran University of Medical Sciences. Patients with a clinical diagnosis of pemphigus with compatible histopathology and direct immune fluorescence (DIF) findings confirming the clinical diagnosis of pemphigus entered the study. The diagnosis of pemphigus vulgaris was made by histology, immunofluorescence pattern of perilesional skin, and indirect immunofluorescence testing of serum. A questionnaire was completed to collect the patient’s data. Clinical Staphylococcus aureus samples which were collected from pemphigus patients with skin and soft tissue infection who were admitted to Tehran dermatology service of Razi Hospital affiliated to the Tehran University of Medical Sciences were taken to the microbiology lab of Kashan Medical Faculty to approve the diagnosis of S. aureus. Samples from the skin and soft tissue infection were collected from all patients and were cultured on sheep blood agar and mannitol salt agar incubated for 24–48 h at 37∘ C. The isolates confirmed to the species level by gram staining, catalase activity, DNase, slide coagulase, and free coagulation of citrated rabbit plasma in tube.

2.2. S. aureus Identification. All swabs were inoculated onto mannitol salt agar, incubated at 37∘ C. Any suspected colony was subcultured on tryptic soy agar and the isolates were confirmed as being S. aureus by colonial morphology, Gram staining, catalase activity, DNase tests, slide coagulase test, and free coagulation of citrated rabbit plasma in tube [11, 12].

2.3. Determination of Methicillin Resistance. Methicillin resistance was evaluated using two methods.The first method was disk diffusion method using Mueller Hinton agar according to the recommendations of Clinical and Laboratory Standards Institute (CLSI), 30 ?g cefoxitin disk (≤21 mm indicated MRSA), and 1 ?g oxacillin disk (≤10 mm indicated MRSA). The second method was polymerase chain reaction (PCR) for the detection of mecA gene (positive indicated MRSA) [13, 14].

2.4. Antimicrobial Susceptibility Testing and Determination of MDR. Antimicrobial susceptibility and resistance were determined by disk diffusion method using Mueller Hinton agar according to the recommendations of Clinical and Laboratory Standards Institute (CLSI) [13]. The following disks were used: oxacillin (1 ?g), penicillin (1 ?g), teicoplanin (30 ?g), tetracycline (30 ?g), azithromycin (15 ?g), clindamycin (2 ?g), cefoxitin (30 ?g), ciprofloxacin (30 ?g), gentamicin (10 ?g), linezolid (30 ?g), daptomycin (30 ?g), amikacin (30 ?g), and cefazolin (30 ?g). The reference strain S. aureus ATCC 3359 was used as a control. Results were interpreted as susceptible, intermediate, or resistant according to the criteria recommended by the CLSI and the manufacturer protocols (Mast Group Ltd., Merseyside, UK). Defining of MDR in S. aureusisolates was done according to new standardized international document. The isolates were classified as multidrug resistant (MDR) if they were resistant to more than three classes of antimicrobial drugs [15].

2.5. Preparation of Genomic DNA. DNA was prepared by boiling. It was stored at −20∘ C. Aliquots of 2 ?L of template DNA were used for PCR. 2.6. Detection of PVL Gene. The presence of the lukS-PV and lukF-PV genes encoding components of PVL was determined by a polymerase chain reaction- (PCR-) based method with the primer pair described in Lina et al. 2 Primers used in this study were as follows: 5? ATCATTAGGTAAAATGTCTGGACATGATCCA 3? as forward and 5? GCATCAASTGTATTGGATAGCAAAAGC 3? as reverse [16]. In this study Staphylococcus aureus strain, ATCC 49775, was used as positive control and distilled water was used as a negative control. DNA amplification was performed on an Eppendorf cycler in a final volume of 20 ?L reaction containing 1.5 mM of MgCl2, 250 ?M dNTPmix, 1 ?M of each primer (20 NM), 1 U of Taq DNA polymerase, 10 mM Tris-HCL (PH 9.0), 30 mM KCL, and 4 ?M of template DNA. Amplification was carried out with first denaturation at 94∘ C for 5 min (first denaturation) followed by 36 cycles according to the following program: denaturation at 94∘ C for 45 sec, annealing at 61.3∘ C for 45 sec, and extension at 72∘ C for 45 sec, plus a final extension at 72∘ C for 5 min to complete partial polymerization. The PCR products were resolved by electrophoresis through a 1.5% agarose gel containing ethidium bromide (Bio-Rad, UK). The PCR purification kit (Bioneer Co., Korea) was used to purify PCR products and sequencing of forward strand was performed by the Bioneer Company (Korea). The nucleotide sequences were analyzed with Chromas 1.45 software and MEGA-4 software and BLAST in NCBI. 2.7. Statistical Analysis. The statistical analysis was performed with SPSS (version 19, Chicago, IL, USA). The chi-square test or Fisher’s exact test was used to compare proportions. A ? value of < 0.05 was considered significant.